Compile Data Set for Download or QSAR
maximum 50k data
Found 65 of ic50 data for polymerid = 50001041
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604814(CHEMBL5185038)
Affinity DataIC50:  540nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604832(CHEMBL5205946)
Affinity DataIC50:  590nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604819(CHEMBL204900)
Affinity DataIC50:  620nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604829(CHEMBL551212)
Affinity DataIC50:  670nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sidPDB
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50121880(CHEMBL216874)
Affinity DataIC50:  700nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604822(CHEMBL1085364)
Affinity DataIC50:  740nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604823(CHEMBL5203198)
Affinity DataIC50:  760nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604817(CHEMBL5203310)
Affinity DataIC50:  780nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604836(CHEMBL5190900)
Affinity DataIC50:  790nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604813(CHEMBL5171144)
Affinity DataIC50:  860nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604827(CHEMBL5196576)
Affinity DataIC50:  870nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50121868(CHEMBL187010)
Affinity DataIC50:  880nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604820(CHEMBL5184216)
Affinity DataIC50:  920nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604838(CHEMBL5172238)
Affinity DataIC50:  1.00E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50121870(CHEMBL3617204)
Affinity DataIC50:  1.10E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50460242(CHEMBL4228948)
Affinity DataIC50:  1.20E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50153250(5,6-Dihydroxy-2-thiophen-2-yl-pyrimidine-4-carboxy...)
Affinity DataIC50:  1.20E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50476511(CHEMBL232444)
Affinity DataIC50:  1.30E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604821(CHEMBL5208893)
Affinity DataIC50:  1.30E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50183501(5,6-dihydroxy-2-(3-methyl-2-thienyl)pyrimidine-4-c...)
Affinity DataIC50:  1.40E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604824(CHEMBL5209461)
Affinity DataIC50:  1.40E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50476539(CHEMBL437708)
Affinity DataIC50:  1.40E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604818(CHEMBL5188107)
Affinity DataIC50:  1.50E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604830(CHEMBL5201304)
Affinity DataIC50:  1.70E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604834(CHEMBL5208229)
Affinity DataIC50:  1.80E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50476518(CHEMBL277754)
Affinity DataIC50:  1.90E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50468804(CHEMBL4284648)
Affinity DataIC50:  1.90E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assayMore data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604812(CHEMBL4174171)
Affinity DataIC50:  2.10E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604828(CHEMBL5182790)
Affinity DataIC50:  2.10E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533377(CHEMBL4475877)
Affinity DataIC50:  2.30E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89-C using dsDNA substrate preincubated for 15 mins followed by substrate addition for 1 hr by ELISAMore data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604831(CHEMBL5177803)
Affinity DataIC50:  2.40E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604815(CHEMBL1077377)
Affinity DataIC50:  2.70E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604833(CHEMBL5187369)
Affinity DataIC50:  2.80E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604835(CHEMBL5199493)
Affinity DataIC50:  3.00E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604816(CHEMBL5185724)
Affinity DataIC50:  3.00E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533401(CHEMBL4445181)
Affinity DataIC50:  3.30E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assayMore data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50571843(CHEMBL4854031)
Affinity DataIC50:  3.50E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assayMore data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50571842(CHEMBL4863466)
Affinity DataIC50:  3.50E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assayMore data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50468811(CHEMBL4280139)
Affinity DataIC50:  3.60E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assayMore data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604826(CHEMBL5200751)
Affinity DataIC50:  3.80E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50571842(CHEMBL4863466)
Affinity DataIC50:  4.20E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89-C using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcac ssDNA as substr...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50571842(CHEMBL4863466)
Affinity DataIC50:  4.20E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50121869(CHEMBL440562)
Affinity DataIC50:  4.50E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604837(CHEMBL5194424)
Affinity DataIC50:  5.00E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50604825(CHEMBL5184235)
Affinity DataIC50:  5.70E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50571841(CHEMBL4877189)
Affinity DataIC50:  5.70E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assayMore data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50571839(CHEMBL4875949)
Affinity DataIC50:  5.80E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assayMore data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50571837(CHEMBL4848335)
Affinity DataIC50:  6.20E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89-CMore data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50571837(CHEMBL4848335)
Affinity DataIC50:  6.20E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assayMore data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50571831(CHEMBL4858935)
Affinity DataIC50:  6.50E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assayMore data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
Displayed 1 to 50 (of 65 total ) | Next | Last >>
Jump to: